Journal: Glycobiology

Article Title: GNE deficiency impairs Myogenesis in C2C12 cells and cannot be rescued by ManNAc supplementation

doi: 10.1093/glycob/cwae004

Figure Lengend Snippet: Supplementation of HEK-293 GNE-knockout cells with ManNAc . A) Representative western blots showing the expression of polySia, its carrier protein NCAM, GNE, and β-tubulin in HEK-293 wild type and GNE-knockout cells in relation to supplementation with different concentrations of ManNAc. B) Representative western blots showing the expression of GlcNAc kinase (NAGK) and β-tubulin in HEK-293 wild type and GNE-knockout cells. β-tubulin is used as a loading control in (a and B). The quantification data in the bar graph represent the mean of three independent experiments ( n = 3). The error bars represent the standard deviation. P -values were calculated using Student’s t-test and are given here in relation to the wild type control. Asterisks above the bars were used to classify Student’s t-test results according to different levels of significance: P ≤ 0.05: * and P ≤ 0.005: * * * .

Article Snippet: GlcNAc kinase (G-5) , GlcNAc kinase (NAGK) , 1:1000 , Santa Cruz Biotechnology , sc-390499.

Techniques: Knock-Out, Western Blot, Expressing, Control, Standard Deviation

Journal: Glycobiology

Article Title: GNE deficiency impairs Myogenesis in C2C12 cells and cannot be rescued by ManNAc supplementation

doi: 10.1093/glycob/cwae004

Figure Lengend Snippet:

Article Snippet: GlcNAc kinase (G-5) , GlcNAc kinase (NAGK) , 1:1000 , Santa Cruz Biotechnology , sc-390499.

Techniques:

Journal: Cell genomics

Article Title: Direct detection of RNA modifications and structure using single-molecule nanopore sequencing

doi: 10.1016/j.xgen.2022.100097

Figure Lengend Snippet: A) Scheme for direct RNA nanopore sequencing. rRNAs containing native modifications are poly(A) tailed before ligation of adapters and RT. Ionic current blockage events are characteristic of the kmer sequence of RNA transiting through the pore constriction. (B) Read quality heatmap for IVT rRNA (left) and native rRNA (right) from E. coli . Dashed red lines indicated the expected lengths for 16S rRNA (1.5 kb) and 23S rRNA (2.9 kb) (C) Normalized native (red) and IVT (black) current signal alignment for 16S rRNA from E. coli spanning positions 1395–1415 performed using Tombo. Sites of known modifications within this window are highlighted in blue. (D) Positional Kolmogorov-Smirnov (KS) statistical testing of current signals across rRNA from E. coli and S. cerevisiae using both Tombo and Nanopolish. Modification positions described in the literature are indicated as black lines. (E) Median current and dwell KS statistic profiles separated by modification type (base [excluding Ψ ], blue; 2'- O -methyl, red; and Ψ , green) and aligned by modification position from both Tombo and Nanopolish. Colored, shaded regions represent the standard deviation of the KS statistic.

Article Snippet: Briefly, 0.5 – 1.0 ug of RNA was poly(A) tailed with 2 ul ATP [10mM], 1 ul [5U] of E. coli Poly(A) polymerase (EPAP) (New England Biolabs) and 2 ul EPAP reaction buffer [2X] in a final volume of 20 ul.

Techniques: Nanopore Sequencing, Ligation, Sequencing, Modification, Standard Deviation

Journal: Cell genomics

Article Title: Direct detection of RNA modifications and structure using single-molecule nanopore sequencing

doi: 10.1016/j.xgen.2022.100097

Figure Lengend Snippet: (A) Dwell time comparison of native (red) and IVT (black) samples (Mann-Whitney U test, n = 1,000 reads) at selected Nm modification sites in 16S and 23S from E. coli and 18S and 25S from S. cerevisiae . Each box spans the interquartile range, the horizontal line within each box defines the median, and the whiskers extend out to the minimum and maximum values. The kmer is indicated below the x axis along with the position of the modification (red). Dwell times are from +Xr from the centered modification site kmer. (B) Sequence motif from the top 1% of dwell times (IVT samples only, 16S, 23S, 18S, and 25S) spanning a 30-nt window encompassing the entire biomolecular sequencing complex. (C) Nucleotide representation (fraction) within the trimer (positions −9, −10, and −11) from IVT samples as a function of dwell time percentile. The highest dwell time percentiles are enriched for guanosine within the trimer.

Article Snippet: Briefly, 0.5 – 1.0 ug of RNA was poly(A) tailed with 2 ul ATP [10mM], 1 ul [5U] of E. coli Poly(A) polymerase (EPAP) (New England Biolabs) and 2 ul EPAP reaction buffer [2X] in a final volume of 20 ul.

Techniques: MANN-WHITNEY, Modification, Sequencing

Journal: Cell genomics

Article Title: Direct detection of RNA modifications and structure using single-molecule nanopore sequencing

doi: 10.1016/j.xgen.2022.100097

Figure Lengend Snippet: (A) Schematic of acylation of RNA with acetylimidazole (AcIm). (B) Time dependence of hydrolysis for AcIm analyzed by changes in UV absorbance. Experiment performed at 37°C. (C) SHAPE-MaP reactivity profiles using NMIA, NAI, and AcIm for E. coli 16S and 23S rRNAs. (D) Two-dimensional kernel density estimates for NMIA, NAI, and AcIm adduct-induced mutation rates for E. coli 16S and 23S rRNAs with unmodified control and SHAPE-modified rates on the x and y axes, respectively. Separation between peak density distributions for paired (blue) versus unpaired (red) positions indicates reaction selectivity with respect to degree of nucleotide flexibility. (E) Receiver operator characteristic curve and associated area under the curve (AUC) for MaP reactivities as a function of pooled nucleotide base-pairing status for SHAPE reagents. True positive rate: unpaired nucleotides with reactivity above a given threshold/total unpaired nucleotides. False positive rate: base-paired nucleotides with reactivity above a given threshold/total base-paired nucleotides.

Article Snippet: Briefly, 0.5 – 1.0 ug of RNA was poly(A) tailed with 2 ul ATP [10mM], 1 ul [5U] of E. coli Poly(A) polymerase (EPAP) (New England Biolabs) and 2 ul EPAP reaction buffer [2X] in a final volume of 20 ul.

Techniques: Mutagenesis, Modification

Journal: Cell genomics

Article Title: Direct detection of RNA modifications and structure using single-molecule nanopore sequencing

doi: 10.1016/j.xgen.2022.100097

Figure Lengend Snippet:

Article Snippet: Briefly, 0.5 – 1.0 ug of RNA was poly(A) tailed with 2 ul ATP [10mM], 1 ul [5U] of E. coli Poly(A) polymerase (EPAP) (New England Biolabs) and 2 ul EPAP reaction buffer [2X] in a final volume of 20 ul.

Techniques: Recombinant, Nanopore Sequencing, Sequencing, Modification, Software

Journal: Cancers

Article Title: P2X7 Receptor Promotes Mouse Mammary Cancer Cell Invasiveness and Tumour Progression, and Is a Target for Anticancer Treatment

doi: 10.3390/cancers12092342

Figure Lengend Snippet: P2X7R is functional in 4T1 mouse mammary cancer cells and drives cell invasiveness. ( a ) RT-PCR analysis of P2X mRNA expression. ( b ) Representative whole-cell patch clamp recordings of ATP-induced currents. Membrane potential was held at −60 mV. While 10 s application of 10 µM ATP (left) evoked no detec current, application of 5 mM ATP produced a non-desensitizing current that was reduced by treatment with 10 µM A438079 (right). ( c ) Recordings of inward currents from one cell in response to 10 s applications of increasing concentrations of ATP (0.3, 1, 3, 5 and 10 mM) (left), and mean ATP dose-response curve, with currents expressed as a ratio of the maximum current obtained with 10 mM ATP (right). The solid line shows fit to Hill equation. ( d ) Changes in intracellular Ca 2+ levels, indicated by the ratio of Fura2 fluorescence intensity induced by excitation at 340 and 380 nm (F 340/380 ), by exposure to 300 µM BzATP in cells under control conditions (black traces) and cells treated with 10 µM A438079 (red traces) in extracellular Ca 2+ -containing solutions (left) or Ca 2+ -free solutions (right). These data are averaged from four independent experiments. There is statistically significant difference in BzATP-induced Ca 2+ responses between control and A438079-treated cells in the presence of extracellular Ca 2+ at p < 0.001, but no significant difference in the absence of extracellular Ca 2+ , using two-way ANOVA and Dunn’s Multiple Comparison post hoc test. ( e ) BzATP-induced Ca 2+ responses in control cells (vehicle, black traces) and cells treated with 300 nM AZ10606120 (blue traces) in the presence of 3 mM extracellular Ca 2+ (left) or in the absence of extracellular Ca 2+ (right), using similar protocols as in d. These data are averaged from three independent experiments. There is a statistically significant difference in BzATP-induced Ca 2+ responses between control and A438079-treated cells in the presence of 3 mM extracellular Ca 2+ at p < 0.001, but no significant difference in the absence of extracellular Ca 2+ , using two-way ANOVA and Dunn’s Multiple Comparison post hoc test. ( f ) Cell viability after exposure to increasing concentrations of ATP (from 0.03 to 3 mM) for 24 h without or with treatment with 10 µM A438079, expressed as % of that under control conditions (vehicle). Results are from four independent experiments. ATP induced a statistically significant cell viability reduction compared to control conditions at * p < 0.05, ** p < 0.01 and *** p < 0.0001, but A438079 treatment had no significant effect on ATP-induced reduction in cell viability, using Student’s t -test. ( g ) Cell viability after exposure to increasing concentrations of BzATP (from 0.01 to 1 mM) for 24 h, expressed as % of that under control condition (vehicle). Results are from four independent experiments. BzATP induced no significant reduction in cell viability. ( h ), 4T1 cell invasiveness, assessed using trans-well invasion inserts after 24 h in the absence or presence of 300 µM BzATP, in cells transfected with control siRNA (siCTL) or P2X7R-specific siRNA (siP2X7). Results from six independent experiments expressed relative to the siCTL condition, in the absence of BzATP stimulation (CTL). ** indicates a statistically significant difference at p < 0.01 when comparing siCTL/BzATP to siCTL/CTL, using Mann-Whitney Rank Sum Test. NS stands for no statistical difference. ( i ) 4T1 2D-cell invasiveness was assessed over 24 h using trans-well invasion inserts in the absence or presence of BzATP (300 µM), and in the absence or presence of P2X7 antagonist A438079 (10 µM). Results are from 4–6 independent experiments and are expressed relatively to the control condition (CTL), in the absence of BzATP and of A438079. * indicates a statistically significant difference at p < 0.05 when comparing BzATP treatment to CTL, using Wilcoxon Signed Rank Test. ( j ) 4T1 3D-cell invasiveness was assessed over 72 h. The left image shows cancer cell spheroid morphology assessed before (T = 0 h) or after treatment (T = 72 h) in control condition (vehicle) or with BzATP (300 µM) in the absence or presence of A438079 (10 µM). Scale bar, 100 µm. On the right side is the summary of assessment of the spheroid circularity from 14–20 independent experiments. * indicates a statistically significant difference at p < 0.05 using Dunn’s Multiple Comparison Test.

Article Snippet: Primary antibodies used were: mouse anti-HSC70 (sc-7298 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), rabbit anti-caveolin 1 (sc-894 Santa Cruz Biotechnology, Inc., Germany), rabbit anti-β-adaptin (610382 BD Biosciences, Le Pont de Claix, France), cathepsin B (20-CR71 Fitzgerald, Acton, MA, USA), cortactin (05-180 Millipore, Guyancourt, France), FAK (036SC-558 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), P2X7 (APR-008 Alomone Labs Ltd., Jerusalem, Israel).

Techniques: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Patch Clamp, Produced, Fluorescence, Transfection, MANN-WHITNEY

Journal: Cancers

Article Title: P2X7 Receptor Promotes Mouse Mammary Cancer Cell Invasiveness and Tumour Progression, and Is a Target for Anticancer Treatment

doi: 10.3390/cancers12092342

Figure Lengend Snippet: P2X7 receptor promotes invadopodial activity of extracellular matrix degradation. ( a ) 4T1 mouse mammary and MDA-MB-435s human cancer cells were grown on Matrigel™ containing DQ-BSA as a fluorogenic substrate for proteases, emitting red fluorescence when degraded. P2X7 receptor was immunodetected using a rabbit primary antibody against P2X7 protein and a secondary ant-rabbit IgG antibody conjugated to AF488. The right panel shows the fluorescence values for the two channels at the locations indicated by a blue arrow. Scale bar, 100 µm. ( b ) Invadopodia entrapped into a 2%-gelatin matrix were fractionated and separated from cytosol and membranes-enriched fractions. The quality of the fractions was assessed by western blotting after SDS-PAGE, using cytosolic (HSC70), membrane (caveolin-1, β-adaptin) and invadopodia (cathepsin B, cortactin, focal adhesion kinase) markers. P2X7 proteins were found to be present in the membrane fractions and enriched in the invadopodia fraction. This figure is representative of 5 independent experiments. The full image blots can be found in . ( c ) The invadopodial activity was assessed as being F-actin foci (green labelling, phalloidin-488) co-localised with focused proteolytic activities (red labelling, DQ-BSA proteolysis) from 4T1 cells grown for 24 h on Matrigel™ containing DQ-BSA in control condition (vehicle), or stimulated with 300 µM BzATP, in the presence and absence of 10 µM A438079. “Coloc” indicates co-localization of degradative activity and F-actin foci and appears as white pixels. Scale bar, 50 µm. ( d ) The number of degradation areas per cell was counted in 20 images, from five independent experiments. * indicates a statistically significant difference at p < 0.05 using Dunn’s Multiple Comparison Test. NS stands for no statistical difference. ( e ) The number of invadopodia (identified as being F-actin foci colocalized with matrix degradation spots) was counted per cell in the same experiments as in d. There was no significant difference among the four treatment conditions. ( f ) Western blot analyses for cathepsin B (Cath B) in concentrated cell-free supernatants of 4T1 cells after 24 h treatment with BzATP (300 µM) in presence or not 10 µM A438079. Pro- and mature forms of Cath B were detected (top). β-actin was detected in corresponding cell lysates and was used as an internal control. Amounts of released mature forms of Cath B in supernatants of 4T1 cells in the three experimental conditions were analysed, from five independent experiments and expressed as a proportion of β-actin in corresponding cells. Box plots indicate median, first and third quartile and the mean is indicated as a square. * indicates a statistically significant difference at p < 0.05 using Dunn’s Multiple Comparison Test. The full image blots can be found in .

Article Snippet: Primary antibodies used were: mouse anti-HSC70 (sc-7298 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), rabbit anti-caveolin 1 (sc-894 Santa Cruz Biotechnology, Inc., Germany), rabbit anti-β-adaptin (610382 BD Biosciences, Le Pont de Claix, France), cathepsin B (20-CR71 Fitzgerald, Acton, MA, USA), cortactin (05-180 Millipore, Guyancourt, France), FAK (036SC-558 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), P2X7 (APR-008 Alomone Labs Ltd., Jerusalem, Israel).

Techniques: Activity Assay, Fluorescence, Western Blot, SDS Page

Journal: Cancers

Article Title: P2X7 Receptor Promotes Mouse Mammary Cancer Cell Invasiveness and Tumour Progression, and Is a Target for Anticancer Treatment

doi: 10.3390/cancers12092342

Figure Lengend Snippet: P2X7 receptor stimulation promotes the acquisition of a mesenchymal phenotype. ( a ) F-actin cytoskeleton was visualized using phalloidin-488 in 4T1 cells stimulated with 300 µM BzATP at the time indicated. Rapid morphological changes appear as rapidly as after 6 min stimulation. Scale bar, 25 µm. ( b ) The number of new filopodia per cell was counted per hour in cells transfected with the LifeAct plasmid and studied in the presence of 300 µM BzATP, in the presence or absence of 10 µM A438079. * indicates a statistically significant difference at p < 0.05 using Dunnett’s Multiple Comparison Test. ( c ) The velocity of filopodia to form and extend (in µm/min) was measured in the same experiments as in ( b ). There was no significant difference among the four experimental groups. ( d ) On the left side, representative western blots show total and active GTP-bound forms of Cdc42, RhoA, and Rac1 pulled down by GST-RBD in 4T1 cells in control conditions or stimulated for 30 min with 300 µM BzATP, in the presence and absence of 10 µM A438079. His-tagged proteins are used as positive controls for the quality of the pull-down experiment. On the right side, graphs show quantifications of GTP-bound RhoGTPases (active form), normalized to total protein level, and expressed relatively to that of the control condition (vehicle). Results are from 4–7 independent experiments. * indicates statistically significant difference at p < 0.05, using Mann-Whitney rank sum test. NS stands for no statistical difference. The full image blots can be found in . ( e ) mRNA expression levels of P2rx7 , SNAI1 , ZEB1 , TWIST1 , ZO1 and CDH1 assessed by RT-qPCR in 4T1 cells stimulated by 300 µM BzATP for 24 h and expressed relatively to the GUSB reference gene and as ratios to the expression levels in control condition without BzATP ( n = 9–11 independent experiments). SNAI1 was significantly higher, and ZO1 was significantly lower after BzATP treatment compared to control condition at * p < 0.05, using Mann-Whitney rank sum test. ( f ) representative western blots (from four independent experiments) show vimentin and E-cadherin expression in 4T1 cells in control conditions or stimulated for 24h with 300 µM BzATP, in the presence and absence of 10 µM A438079. There was no significant effect. The full image blots can be found in .

Article Snippet: Primary antibodies used were: mouse anti-HSC70 (sc-7298 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), rabbit anti-caveolin 1 (sc-894 Santa Cruz Biotechnology, Inc., Germany), rabbit anti-β-adaptin (610382 BD Biosciences, Le Pont de Claix, France), cathepsin B (20-CR71 Fitzgerald, Acton, MA, USA), cortactin (05-180 Millipore, Guyancourt, France), FAK (036SC-558 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), P2X7 (APR-008 Alomone Labs Ltd., Jerusalem, Israel).

Techniques: Transfection, Plasmid Preparation, Western Blot, MANN-WHITNEY, Expressing, Quantitative RT-PCR

Journal: Cancers

Article Title: P2X7 Receptor Promotes Mouse Mammary Cancer Cell Invasiveness and Tumour Progression, and Is a Target for Anticancer Treatment

doi: 10.3390/cancers12092342

Figure Lengend Snippet: P2X7 receptor in mammary cancer cells enhances primary tumour growth and metastatic development in vivo. ( a ) P2rx7 mRNA expression levels assessed by RT-qPCR in CTL, Crispr#1 and Crispr#2 cell lines, expressed relatively to 4T1 cells. * indicated a statistically significant difference from CTL cells at p < 0.05 using Mann-Whitney Rank sum test. ( b ) 2-D cancer cell invasiveness of CTL, Crispr#1 and Crispr#2 cell lines, in the absence or presence of 300 µM BzATP, expressed relatively to the CTL cell line without BzATP ( n = 5–8 independent experiments). * indicates a statistically significant difference from CTL/no BzATP condition at p < 0.05, ¤ indicates a statistically significant difference from CTL/BzATP at p < 0.05, using Dunn’s Multiple Comparison Test. NS, stands for no statistically significant difference. ( c ) Cell proliferation over 4 days of CTL, Crispr#1 and Crispr#2 cell lines in the absence of 300 µM BzATP, expressed relatively to the CTL condition. Results are from 6–10 independent experiments. * indicates a statistically significant difference from CTL at p < 0.05 using Dunn’s Multiple Comparison Test. ( d ) Cell adhesion of CTL, Crispr#1 and Crispr#2 clones, expressed relatively to CTL. Results are from 10 independent experiments. * indicates a statistically significant difference from CTL at p < 0.05 using Dunn’s Multiple Comparison Test. ( e–i ) In vivo mouse experiments testing the effect of P2rx7 gene expression in host mice on primary tumour growth and metastasis development, with two numbers of cancer cells implanted. ( e ) Top, cartoon describing the experimental procedure, in which CTL cells, derived from 4T1-Luc expressing P2rx7 gene, were implanted to the fifth mammary fat pad of 6 weeks-old female wild-type BALB/cJ ( P2rx7 + / + ) or P2X7 knock-out BALB/cJ (P2rx7 − / − ) mice. Bottom, representative bioluminescent images of a wild-type mouse, on 14 and 35 days after cell implantation, identifying primary tumours as well as metastatic foci. ( f ) Primary mammary tumour growth in wild-type BALB/cJ ( P2rx7 + / + , n = 8) or P2X7 knock-out BALB/cJ (P2rx7 − / − , n = 8) mice as a function of time following the implantation of 1 × 10 6 CTL cells on day 0. ( g ) Analysis of the number of metastases per mouse, identified at necropsy, in the experiment described in ( f ). NS stands for no statistical significant difference. ( h ) Primary mammary tumour growth in wild-type BALB/cJ ( P2rx7 + / + , n = 8) or P2X7 knock-out BALB/cJ ( P2rx7 − / − , n = 8) mice as a function of time following the implantation of 1 × 10 4 CTL cells on day 0. ( i ) Analysis of the number of metastases per mouse, identified at necropsy, in the experiment described in ( h ). NS stands for no statistically significant difference. ( j–l ) In vivo mouse experiments assessing the role of P2rx7 gene expression in mammary cancer cells on primary tumour growth and metastasis development. ( j ) Cartoon describing the experimental procedure, in which CTL ( P2rx7 + / + ), Crispr#1 or Crispr#2 (both knock-down for the P2rx7 expression) cells were implanted to the fifth mammary fat pad of 6 weeks-old female wild-type BALB/cJ ( P2rx7 + / + ) at a density of 1 × 10 4 CTL cells per mouse (8 mice per group). ( k ) Primary mammary tumour growth in wild-type BALB/cJ ( P2rx7 + / + ) as a function of time following the implantation of CTL, Crispr#1 or Crispr#2 cells on day 0. *** indicates a statistically significant difference from the CTL group at p < 0.001 using two-way ANOVA. ( l ) Analysis of the number of metastases per mouse, in the three experimental groups, identified at necropsy, in the experiment described in ( j ). * indicates a statistically significant difference from the CTL group at p < 0.05 using Dunn’s Multiple Comparison test.

Article Snippet: Primary antibodies used were: mouse anti-HSC70 (sc-7298 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), rabbit anti-caveolin 1 (sc-894 Santa Cruz Biotechnology, Inc., Germany), rabbit anti-β-adaptin (610382 BD Biosciences, Le Pont de Claix, France), cathepsin B (20-CR71 Fitzgerald, Acton, MA, USA), cortactin (05-180 Millipore, Guyancourt, France), FAK (036SC-558 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), P2X7 (APR-008 Alomone Labs Ltd., Jerusalem, Israel).

Techniques: In Vivo, Expressing, Quantitative RT-PCR, CRISPR, MANN-WHITNEY, Clone Assay, Derivative Assay, Knock-Out

Journal: Cancers

Article Title: P2X7 Receptor Promotes Mouse Mammary Cancer Cell Invasiveness and Tumour Progression, and Is a Target for Anticancer Treatment

doi: 10.3390/cancers12092342

Figure Lengend Snippet: P2X7 antagonism slows mammary tumour growth. ( a ) In vivo mouse experiments assessing the effects of treatments with two P2X7 antagonist (A438079 or AZ10606120) on primary tumour growth, in which cancer cells and host organisms both express the P2rx7 gene. ( b ) primary mammary tumour growth represented as a function of the duration of the treatment depending on antagonist treatments (A438079 or AZ10606120) compared to the injection of vehicle. ( c – e ) A Gompertz model was used to assess mammary tumour growth as a function of time for ( c ), vehicle group, ( d ), A438079 and ( e ), AZ10606120. Black, red and blue dots represent individual tumour volumes of these respective categories, blue areas are 90% model prediction intervals and lines are the median tumour growth. Estimated mean (inter-individual standard deviation) of model parameters were k growth = 0.64 day-1 (39%), V max = 1.620 mm 3 (64%), EFF = 0.52 (82%) and γ = 0.17 (–). This analysis showed that tumour volume doubled in a mean time of 0.64 day, that the mean maximum tumour volume was 1.620 mm 3 and that tumour growth was twice slower in the presence of A438079 or AZ10606120 treatment ( p < 10 −10 ) as compared to the vehicle group. There was no difference in the efficacy of these two treatments ( p = 0.08). ( f ) Assessment of the number of metastases per mouse, in the three experimental groups; vehicle, A438079 and AZ10606120. There was no statistical difference. ( g ) Percent survival curve in the three experimental group indicating a significant prolonged survival of mice treated with AZ10606120 at p = 0.0464 using Gehan-Breslow-Wilcoxon Test.

Article Snippet: Primary antibodies used were: mouse anti-HSC70 (sc-7298 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), rabbit anti-caveolin 1 (sc-894 Santa Cruz Biotechnology, Inc., Germany), rabbit anti-β-adaptin (610382 BD Biosciences, Le Pont de Claix, France), cathepsin B (20-CR71 Fitzgerald, Acton, MA, USA), cortactin (05-180 Millipore, Guyancourt, France), FAK (036SC-558 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), P2X7 (APR-008 Alomone Labs Ltd., Jerusalem, Israel).

Techniques: In Vivo, Injection, Standard Deviation

Journal: Cancers

Article Title: P2X7 Receptor Promotes Mouse Mammary Cancer Cell Invasiveness and Tumour Progression, and Is a Target for Anticancer Treatment

doi: 10.3390/cancers12092342

Figure Lengend Snippet: Sequences of conventional Polymerase Chain Reactions (PCR) and quantitative Polymerase Chain Reactions (qPCR) primers and expected amplicon size.

Article Snippet: Primary antibodies used were: mouse anti-HSC70 (sc-7298 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), rabbit anti-caveolin 1 (sc-894 Santa Cruz Biotechnology, Inc., Germany), rabbit anti-β-adaptin (610382 BD Biosciences, Le Pont de Claix, France), cathepsin B (20-CR71 Fitzgerald, Acton, MA, USA), cortactin (05-180 Millipore, Guyancourt, France), FAK (036SC-558 Santa Cruz Biotechnology, Inc., Heidelberg, Germany), P2X7 (APR-008 Alomone Labs Ltd., Jerusalem, Israel).

Techniques: Amplification

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: Venetoclax enhances the cytotoxicity of cord blood and AML patient-derived NK cells against AML in vitro (A) Schematic representation of the cytotoxicity assays using CB-NK cells. (B and C) Untreated CB-NK cells or those pretreated with 400 nM venetoclax for 18 h were incubated with KG-1a or THP-1 cells (2 × 10 4 cells per well) at different effector-to-target ratios for 4 h, followed by Annexin V/7-AAD assay ( n = 3/4, biological replicates). The results represent three independent experiments using NK cells from different donors. The calculation of the specific killing is provided in the . (D) Representative flow cytometry plots (left) and summary data (right) of CD107a ( n = 7, biological replicates) and IFN-γ ( n = 10, biological replicates) production by CB-NK cells treated with or without 400 nM venetoclax. The results represent three independent experiments. (E) Colony formation assay using KG-1a cells co-cultured with venetoclax-treated or untreated CB-NK cells at a ratio of 2.5:1 ( n = 3, biological replicates). Equal numbers of AML cells (2 × 10 3 cells per dish) were used in the colony formation assays, and the colonies were counted after 14 days. The results represent three independent experiments using NK cells from three different donors, with detailed experimental procedures in the . (F) Cytotoxicity assay using venetoclax-treated or untreated CB-NK cells (5 × 10 4 cells per well) against primary AML cells from newly diagnosed ( n = 6, biological replicates) or relapsed patients ( n = 5, biological replicates) at a 2.5:1 ratio for 4 h. Primary AML cell viability was assessed using flow cytometry with the Annexin V/7-AAD assay. The results represent three independent experiments using NK cells from different donors. (G) Colony formation assay using primary AML cells co-cultured with venetoclax-treated or untreated CB-NK cells at a ratio of 2.5:1 ( n = 3, biological replicates). Equal numbers of primary AML cells (1 × 10 4 cells per dish) were used in the colony formation assays, and the colonies were counted after 14 days. The results represent three independent experiments using NK cells and primary AML cells from different donors. (H) Experimental setup of co-culture assays using NK cells derived from fresh bone marrow (BM) of newly diagnosed patients with AML. (I) Cytotoxicity assay using NK cells derived from fresh AML BM samples (5 × 10 4 cells per well) treated with or without 400 nM venetoclax against KG-1a cells ( n = 3, biological replicates) or autologous AML cells ( n = 6, biological replicates) at a 2.5:1 ratio for 4 h. The results for autologous AML cells are representative of four independent experiments using NK cells from six different donors. Data were analyzed using two-tailed unpaired Student’s t test (B, C, F, and I), paired Student’s t test (D), or one-way ANOVA with Tukey’s multiple comparisons test (E and G). Data are presented as mean ± standard deviation (SD). See also Figures S1 and .

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Derivative Assay, In Vitro, Incubation, Flow Cytometry, Colony Assay, Cell Culture, Cytotoxicity Assay, Co-Culture Assay, Two Tailed Test, Standard Deviation

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: Venetoclax potentiates NK cell-mediated cytotoxicity against AML in vivo (A) Schematic illustration of KG-1a mouse model construction (3 groups, n = 8/group). (B) Representative flow cytometry plots (left) and quantification (right) illustrating BM engraftment of KG-1a cells. Two weeks post-injection of KG-1a cells, engraftment of KG-1a cells (human CD45 + , gating from human CD3 − CD56 − ) in the BM was determined by flow cytometry. NK cells used for in vivo studies were generated following the procedures described in the . The results were obtained from three independent experiments using NK cells from eight donors. (C) Schematic outline of AML patient-derived xenograft model generation (3 groups, n = 5/group). (D) Representative flow cytometry plots (left) and quantification illustrating BM engraftment of primary AML cells (right). Four weeks post-AML injection, the engraftment of primary AML cells (human CD45 + CD33 + ) in the BM was assessed through flow cytometry. NK cells used for in vivo studies were generated following the procedures described in the . The results were obtained from three independent experiments. (E and F) Representative images of Wright-Giemsa BM smear staining of KG-1a (left) and primary AML cell (right) xenograft mice. Red arrowheads indicate leukemia cells. (G) Schematic outline of HL60-Luc mouse model construction (3 groups, n = 10/group), with detailed experimental procedures in the . AML burden was monitored by bioluminescence imaging at the indicated time points. (H) Kinetic analysis of AML burden in each group assessed by bioluminescence imaging. Statistical analysis was performed for the average radiance between venetoclax-pretreated and non-pretreated NK cell groups 14 days post-NK cell infusion. (I) Kaplan-Meier survival analysis of HL60-Luc-engrafted mice. (J) Imaging of AML burden using bioluminescence. Statistical significance was determined using one-way ANOVA with Tukey’s multiple comparisons test (B and D), unpaired Student’s t test (H), or log rank Mantel-Cox test (I). For (B) and (D), the data are presented as mean ± SD. For (H), data are presented as mean ± SEM.

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: In Vivo, Flow Cytometry, Injection, Generated, Derivative Assay, Staining, Imaging

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: Venetoclax treatment increases NK cell avidity for AML cells and promotes lytic granule polarization during immune synapse formation (A) Volcano plot of differentially expressed genes (DEGs) between the control and venetoclax-treated groups, with selected DEGs labeled. (B) The distribution of DEG values in each sample from RNA-seq while classifying genes with similar functions. (C) GO term enrichment analysis of upregulated DEGs in the venetoclax-treated group. (D) F-actin (red) and perforin (green) staining in cell conjugates was acquired at different time points after mixing CB-NK cells (1 × 10 5 cells per well) treated or untreated with 400 nM venetoclax with KG-1a cells at a ratio of 1:1. (E) Granule-to-synapse distance was quantified for 15–55 conjugates per group. The results represent two independent experiments. (F) Schematic diagram of the single-cell avidity binding experimental outline. (G) Representative bright-field raw micrographs of a microfluidic chip loaded with KG-1a cells and exposed to venetoclax-treated or untreated NK cells for 10 min before gradually applying force up to 1,000 pN. Orange circles represent bound effectors, while green circles represent regions where effectors were bound at the start of force application but then dislodged. (H) Evaluation of binding avidity between venetoclax-treated or untreated NK cells and KG-1a targets using acoustic force microfluidic microscopy. (I) Normalized fold change in the binding of venetoclax-treated NK cells compared to that of untreated NK cells from (H), n = 3. (J) Cell-binding avidity from (H) at 1,000 pN, n = 3. Data are presented as mean ± SD for (H)–(J). Statistical significance was determined using unpaired Student’s t test (E and J). See also Figure S3 .

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Control, Labeling, RNA Sequencing, Staining, Single Cell, Binding Assay, Microscopy

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: scRNA-seq analysis reveals notable expansion and transcriptomic alterations in CD161 low CD218b + NK cell subpopulation following venetoclax treatment (A) scRNA-seq workflow chart. CB-NK cells were isolated from CB, treated with or without venetoclax (400 nM for 18 h), and then subjected to scRNA-seq using the 10× platform (control group n = 4; venetoclax-treated group n = 4). (B) Uniform manifold approximation and projection (UMAP) visualization of major cell types from the scRNA-seq data after quality control. (C) Heatmap showing the expression of marker genes in the five indicated clusters. (D) Representative cluster GO terms. (E) Pie charts displaying the percentage of cells assigned to each cluster within the indicated groups. (F) Pie charts comparing the proportions of NK cell subclusters (left, log 2 odds ratio) and the number of DEGs (right) in each subpopulation in the venetoclax-treated group vs. the control group. (G) Violin plot displaying the expression of KLRB1 and IL-18RAP in each cell subcluster. (H) Representative flow cytometry plots (left) and summary data (right) of C3 NK cells within total NK cell population from the control and venetoclax (400 nM for 18 h)-treated groups ( n = 7, biological replicates). The results represent three independent experiments. (I) Specific killing ability of NK cell subsets (sorted based on CD161 and CD218b, 2 × 10 4 cells per well) co-cultured with KG-1a cells at a 1:1 ratio for 4 h. The values in red indicate the fold change in the mean value in the venetoclax-treated group compared to the control group. The results represent three independent experiments. (J) Flow cytometric analysis of IFN-γ ( n = 7, biological replicates), CD107a ( n = 3, biological replicates), perforin ( n = 7, biological replicates), and granzyme B ( n = 7, biological replicates) expression in the venetoclax (400 nM for 18 h)-treated or untreated C3 NK cells. The results represent three independent experiments. CD107a expression in C3 NK cells was assessed through flow cytometry following stimulation with KG-1a cells. Statistical significance was determined using unpaired Student’s t test (I), paired Student’s t test (H and J), or hypergeometric test (D). Data are presented as mean ± SD. See also Figure S4 .

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Isolation, Control, Expressing, Marker, Flow Cytometry, Cell Culture

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: Venetoclax treatment upregulates mitochondrial energy metabolism and increases NF-κB activity in NK cells (A) Enriched GO terms of upregulated DEGs in the C3 subpopulation between the control and venetoclax-treated groups. (B) Expression of OXPHOS-related genes in C3 NK cells. (C and D) Representative images (C) and quantification (D) of the mitochondrial phenotype in C3 NK cells (control group, n = 27; venetoclax-treated group, n = 54; green, MitoTracker Green, an indicator of mitochondrial mass; red, MitoTracker Red CMXRos, an indicator of mitochondrial membrane potential; blue, Hoechst, a dye for cell nuclei). The results represent two independent experiments. (E) Violin plot showing the NF-κB activation signal score and expression levels of representative NF-κB target genes in C3 NK cells. (F and G) Expression of p-p65 (F, n = 7, biological replicates) and p -IKKα (G, n = 4, biological replicates) in venetoclax (400 nM for 18 h)-treated or untreated C3 NK cells analyzed by flow cytometry. The results represent three independent experiments. (H) Confocal microscopy images (left) and quantification (right) of intranuclear p-p65 signal intensity in venetoclax (400 nM for 18 h)-treated or untreated C3 NK cells (control group, n = 76; venetoclax-treated group, n = 104). The results represent three independent experiments using NK cells from different donors. (I) GO terms of genes upregulated following venetoclax treatment of total NK cells. (J) Oxygen consumption rate (OCR) of venetoclax-treated (400 nM for 18 h) or untreated total NK cells ( n = 4, biological replicates). (K) Spare respiratory capacity calculated from (J). (L) ATP assay was conducted to evaluate total ATP production, mitochondrial oxidative phosphorylation-derived ATP (mito-ATP), and glycolysis-derived ATP (glyco-ATP) in total NK cells treated with 400 nM venetoclax for 18 h or left untreated. Statistical analysis was performed for mito-ATP between the control and venetoclax-treated groups ( n = 9–10, biological replicates). (M) The p-p65 expression level in total NK cells treated with or without 400 nM venetoclax for 18 h was detected by flow cytometry ( n = 8, biological replicates). The results represent three independent experiments using NK cells from different donors. (N and O) Confocal microscopy images (N) and quantification of p-p65 intranuclear signal intensity (O) in total NK cells treated with or without 400 nM venetoclax for 18 h. The results represent three independent experiments using NK cells from different donors. (P) Quantitative real-time PCR data showing changes in BCL-xL mRNA expression in CB-NK cells after 400 nM venetoclax treatment for 18 h ( n = 6, biological replicates). The results represent three independent experiments using NK cells from different donors. Statistical significance was determined by unpaired Student’s t tests (D, H, K, L, O, and P), paired Student’s t tests (F, G, and M), hypergeometric tests (A and I), and the Mann-Whitney test (E). Data are presented as mean ± SD. See also Figure S5 .

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Activity Assay, Control, Expressing, Membrane, Activation Assay, Flow Cytometry, Confocal Microscopy, ATP Assay, Phospho-proteomics, Derivative Assay, Real-time Polymerase Chain Reaction, MANN-WHITNEY

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: Venetoclax enhances mitochondrial metabolism via NF-κB activation in NK cells (A) Correlation between the NF-κB activation signature and OXPHOS signature in venetoclax-treated or untreated C3 NK cells. (B) OCR kinetics in C3 NK cells treated with 400 nM venetoclax, 25 μg/mL SN50 (a cell-permeable inhibitor of NF-κB translocation) or venetoclax plus SN50 or left untreated. (C–F) Quantification of basal OCR (C), maximal OCR (D), spare respiratory capacity (E), and ATP production rate (F) derived from (B), n = 9, biological replicates. (G) Confocal microscopy images (left) showing MitoTracker Green and MitoTracker Red CMXRos staining in C3 NK cells treated with 25 μg/mL SN50, 400 nM venetoclax, or venetoclax plus SN50 or left untreated. The graphs (right) show the corresponding quantification of the mean fluorescence intensity (one data point per cell). Results from two independent experiments as presented. (H) Correlation between the NF-κB activation signature and OXPHOS signature in venetoclax-treated or untreated total NK cells. (I) Confocal microscopy images (left) and statistical analysis (right) illustrating MitoTracker Green and MitoTracker Red CMXRos staining in total NK cells treated with 25 μg/mL SN50, 400 nM venetoclax, or venetoclax plus SN50 or left untreated. The results represent two independent experiments. Statistical significance was determined by one-way ANOVA with Tukey’s multiple comparisons test (C–G and I) and hypergeometric test (A and H). Data are presented as mean ± SD. For (B), data are presented as mean ± SEM.

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Activation Assay, Translocation Assay, Derivative Assay, Confocal Microscopy, Staining, Fluorescence

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet: Venetoclax boosts mitochondrial metabolism via NF-κB to facilitate IS formation in NK cells (A) Representative confocal images of cell conjugates after NK cell/KG-1a cell contact under the indicated conditions stained with F-actin (red) and perforin (green). NK cells (1 × 10 5 cells per well) treated with venetoclax (400 nM), SN50 (25 μg/mL), or venetoclax plus SN50 or left untreated were co-cultured with KG-1a cells at a 1:1 ratio for 1 h. White arrows indicate perforin. (B) Granule-to-synapse distance quantified for 33–47 conjugates per group. The results represent three independent experiments. The distance from the perforin to the IS was determined as described in Figure S3 G. (C) MitoTracker Deep Red (cyan), F-actin (red), and DAPI (blue) staining in cell conjugates after NK cell/KG-1a cell contact under the indicated conditions. NK cells (1 × 10 5 cells per well) treated with venetoclax (400 nM), SN50 (25 μg/mL), or venetoclax plus SN50 or left untreated were co-cultured with KG-1a cells for 30 min at a ratio of 1:1. White arrows indicate mitochondria. (D) Mitochondria-to-synapse distance quantified for 39–71 conjugates per group. The results represent three independent experiments. The distance from the mitochondria to the IS was determined as described in Figure S3 G. (E) F-actin (red) and perforin (green) staining in cell conjugates after NK cell/KG-1a cell contact under the indicated conditions. NK cells (1 × 10 5 cells per well) treated with venetoclax (400 nM), oligomycin A (200 nM), or venetoclax plus oligomycin A or left untreated were co-cultured with KG-1a cells for 1 h at a ratio of 1:1. White arrows indicate perforin. (F) The granule-to-synapse distance quantified for 32–45 conjugates per group. The results represent three independent experiments. The distance from perforin to the IS was determined as described in Figure S3 G. (G) F-actin (red) and perforin (green) staining in cell conjugates after NK cell/KG-1a cell contact under the indicated conditions. NK cells (1 × 10 5 cells per well) treated with venetoclax (400 nM), rotenone (200 nM), or venetoclax plus rotenone or left untreated were co-cultured with KG-1a cells for 1 h at a ratio of 1:1. White arrows indicate perforin. (H) The granule-to-synapse distance quantified for 24–63 conjugates per group. The results represent three independent experiments. The distance from perforin to the IS was determined as described in Figure S3 G. (I) The immune-synapse-binding avidity of NK cells, treated with venetoclax (400 nM) or venetoclax plus SN50 (25 μg/mL) or left untreated, to KG-1a cells was assessed via acoustic force microfluidic microscopy. (J) Cell-binding avidity from (J) at 1,000 pN, n = 3. (K and L) Representative flow cytometry plots and quantification of the specific killing ability of CB-NK cells (5 × 10 4 cells per well) treated with venetoclax (400 nM), oligomycin A (200 nM), rotenone (200 nM), venetoclax plus oligomycin A, or venetoclax plus rotenone or left untreated against KG-1a cells at a 2.5:1 ratio for 4 h ( n = 11, biological replicates). The results represent six independent experiments. Representative flow plots showing NK cells derived from the same donor. (M) Flow cytometry analysis of the percentage of Annexin V + KG-1a cells co-cultured for 4 h at a 2.5:1 ratio with total NK cells (5 × 10 4 cells per well) pretreated with venetoclax (400 nM), SN50 (25 μg/mL), or venetoclax plus SN50 or left untreated ( n = 13, biological replicates). The results represent six independent experiments. Statistical significance was determined by one-way ANOVA with Tukey’s multiple comparisons test (B, D, F, H, and J–M). Data are presented as mean ± SD. See also Figure S6 .

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Staining, Cell Culture, Binding Assay, Microscopy, Flow Cytometry, Derivative Assay

Journal: Cell Reports Medicine

Article Title: Venetoclax acts as an immunometabolic modulator to potentiate adoptive NK cell immunotherapy against leukemia

doi: 10.1016/j.xcrm.2024.101580

Figure Lengend Snippet:

Article Snippet: For pretreatment with the NF-κB inhibitors SN50 (25 μg/mL, MCE, Cat # HY-P0151), BAY 11–7082 (1 μM, MCE, Cat# HY-13453), and PDTC (5 μM, MCE, Cat# HY-18738), CB-NK cells were centrifuged and then resuspended in IMDM complete medium plus NF-κB inhibitors for 4 h, followed by 400 nM venetoclax for 18 h. For pretreatment with metabolism inhibitors, CB-NK cells were resuspended in IMDM complete medium plus Oligomycin A (200 nM, MCE, Cat# HY-16589) or rotenone (200 nM, MCE, Cat# HY-B1756) combined with venetoclax (400 nM) for 18 h. All cells were cultured in a humidified incubator (37°C, 5% CO2).

Techniques: Recombinant, Staining, Blocking Assay, CCK-8 Assay, Western Blot, Cell Isolation, Single Cell RNA-Seq, Software

Journal: Cell reports

Article Title: Global post-translational modification profiling of HIV-1-infected cells reveals mechanisms of host cellular pathway remodeling

doi: 10.1016/j.celrep.2022.110690

Figure Lengend Snippet: (A) Heatmap of log 2 fold changes by comparison for differentially abundant proteins that could be mapped to a specific HIV-1 accessory protein. (B) Scatterplots of ubiquitination changes (in the presence of proteasome inhibition) versus protein abundance changes for proteins in (A). (C) Network view of putative Vif-, Vpr-, and Vpu-dependent ubiquitination. See legend for node and edge definitions. (D) Top 3 MS1 intensity analysis of ubiquitin and ubiquitin-like proteins ISG15 and NEDD8. (E) Bar graph of the number of proteins with N differentially abundant ubiquitination sites in the WT/mock comparison. (F) Scatterplot of ubiquitination log 2 fold changes for multiply, differentially ubiquitinated proteins in the WT/mock comparison. Each point represents the log 2 fold change of a ubiquitination site versus the next consecutive ubiquitination site in the protein sequence. See also .

Article Snippet: Ubiquitin Remnant Motif (K-ε-GG) immunoaffinity beads , Cell Signaling , Cat# 5562.

Techniques: Comparison, Ubiquitin Proteomics, Inhibition, Quantitative Proteomics, Sequencing

Journal: Cell reports

Article Title: Global post-translational modification profiling of HIV-1-infected cells reveals mechanisms of host cellular pathway remodeling

doi: 10.1016/j.celrep.2022.110690

Figure Lengend Snippet: (A) Schematic of histone h1 protein domains (top; positions indicated are for histone H1.2). Heatmap of ubiquitination changes on histone H1 variants. All sites are aligned to the sequence positions of histone H1.2. Cells with a red outline were identified by peptides that cannot distinguish between histone variants. (B) Denaturing ubiquitin immunoprecipitation analysis of histone H1.2 with Vpr titration. (C) Denaturing ubiquitin immunoprecipitation analysis of histone H1.2 with MLN4924 titration. (D) Schematic of experimental and data analysis workflows for quantitative AP-MS analysis of histone H1.2 in the presence and absence of Vpr co-expression. (E) Volcano plot of histone H1.2 protein binding changes in response to Vpr expression. Proteins with |log 2 fold change| > 0.58 (i.e., 1.5-fold change) and adjusted p value < 0.05 are highlighted in red. (F) Schematic of a fluorescence-based assay for HDR of DNA double-strand breaks. (G) HDR assay of cells in response to VPR expression and MLN4924 treatment. Bar heights represent an average of three biological replicates and error bars indicate the standard deviation (n = 3 biological replicates). (H) A model for HIV-1 VPR-mediated inhibition of histone H1 ubiquitination, DNA repair, cell-cycle arrest, and cell death. See also and .

Article Snippet: Ubiquitin Remnant Motif (K-ε-GG) immunoaffinity beads , Cell Signaling , Cat# 5562.

Techniques: Ubiquitin Proteomics, Sequencing, Immunoprecipitation, Titration, Protein-Protein interactions, Expressing, Protein Binding, Fluorescence, Standard Deviation, Inhibition

Journal: Cell reports

Article Title: Global post-translational modification profiling of HIV-1-infected cells reveals mechanisms of host cellular pathway remodeling

doi: 10.1016/j.celrep.2022.110690

Figure Lengend Snippet:

Article Snippet: Ubiquitin Remnant Motif (K-ε-GG) immunoaffinity beads , Cell Signaling , Cat# 5562.

Techniques: Ubiquitin Proteomics, Control, Magnetic Beads, Virus, Recombinant, Sequencing, Enzyme-linked Immunosorbent Assay, Mass Spectrometry, Software, Cell Isolation

Journal: Journal of Hematology & Oncology

Article Title: Control of triple-negative breast cancer using ex vivo self-enriched, costimulated NKG2D CAR T cells

doi: 10.1186/s13045-018-0635-z

Figure Lengend Snippet: Surface expression of NKG2D ligands on TNBC cell lines. A panel of human TNBC cell lines were stained with recombinant NKG2D-Fc or specific antibodies that recognize MICA/B; ULBP-1, ULBP-2/5/6, ULBP-3, or ULBP-4 (solid line histogram); matched isotype or irrelevant recombinant protein-Fc controls (dashed line histogram) and analyzed by flow cytometry. A breast cancer cell line, MCF7, was used as a positive control

Article Snippet: Recombinant human NKG2D Fc chimera and a control recombinant human folate receptor-alpha (FRA) Fc chimera were purchased from R&D System.

Techniques: Expressing, Staining, Recombinant, Flow Cytometry, Positive Control

Journal: Journal of Hematology & Oncology

Article Title: Control of triple-negative breast cancer using ex vivo self-enriched, costimulated NKG2D CAR T cells

doi: 10.1186/s13045-018-0635-z

Figure Lengend Snippet: Construction and expression of NKG2D CARs. a Schematic illustration of the lentiviral construct for the NKG2D CARs. NKG2D CAR sequences were preceded in frame by a green fluorescent protein (GFP) sequence followed by the 2A ribosomal skipping sequence. NKG2D CAR contains the extracellular portion of the human NKG2D receptor, which linked to a CD8a hinge and transmembrane region, followed by a CD3z signaling moiety alone (GFP-NKG2D-z) or in tandem with the 4-1BB (GFP-NKG2D-BBz) or CD27 (GFP-NKG2D-27z) intracellular signaling motif. b NKG2D CAR and GFP coexpressed by CD3+ T cells 14 days after transduction. UNT T cells only express endogenous NKG2D

Article Snippet: Recombinant human NKG2D Fc chimera and a control recombinant human folate receptor-alpha (FRA) Fc chimera were purchased from R&D System.

Techniques: Expressing, Construct, Sequencing, Transduction

Journal: Journal of Hematology & Oncology

Article Title: Control of triple-negative breast cancer using ex vivo self-enriched, costimulated NKG2D CAR T cells

doi: 10.1186/s13045-018-0635-z

Figure Lengend Snippet: Recognition of human TNBC cells by NKG2D CAR T cells in vitro . a NKG2D CAR-modified T cells secrete IFN-γ during overnight co-culture with NKG2DL-expressing TNBC cells, but not NKG2DL-negative AE17 mesothelioma cells. Mean IFN-γ concentration ± SD (pg/ml) from triplicate cultures is shown. b Lysis of NKG2DL-expressing TNBC cells (MDA-MB-231 fluc) by NKG2D CAR T cells in an 18-h bioluminescence assay at the indicated effector-to-target ( E / T ) ratios. Untransduced (UNT) CD3+ human T cells and AE17 mesothelioma cells served as negative effector and target cell controls, respectively. c Normalized cell index(CI) plot for target cells (AE17, BT549, MDA-MB-436, and MDA-MB-468) incubated with UNT or NKG2D CAR T cells at different E : T ratios for 24 h. When seeded alone, target cells adhere to the plate and proliferate, increasing the CI readout (red lines). When T cells added to target cells, NKG2CD CAR T cells cause cell cytolysis and subsequent progressive decrease in CI. Y -axis is the normalized CI generated by the RTCA software and displayed in real time. X -axis is the time of cell culture and treatment time in hour. Mean values of the CI were plotted ± standard deviation. d The cell index plot is converted to a % Lysis plot by the xCELLigence Immunotherapy Software

Article Snippet: Recombinant human NKG2D Fc chimera and a control recombinant human folate receptor-alpha (FRA) Fc chimera were purchased from R&D System.

Techniques: In Vitro, Modification, Co-Culture Assay, Expressing, Concentration Assay, Lysis, ATP Bioluminescent Assay, Incubation, Generated, Software, Cell Culture, Standard Deviation

Journal: Journal of Hematology & Oncology

Article Title: Control of triple-negative breast cancer using ex vivo self-enriched, costimulated NKG2D CAR T cells

doi: 10.1186/s13045-018-0635-z

Figure Lengend Snippet: NKG2D CAR (GFP) expression on T cells in the presence and absence of IL-2. Percentages of NKG2D CAR (GFP+) cells, presented as the mean ± SD were derived from three independent donors during a 3-week culture period in the presence of IL-2 (50 IU/ml) ( a ) or absence of IL-2 ( b ). c The kinetic monitoring of GFP (NKG2D CAR) expression on one representative donor of three in the presence or absence of IL-2

Article Snippet: Recombinant human NKG2D Fc chimera and a control recombinant human folate receptor-alpha (FRA) Fc chimera were purchased from R&D System.

Techniques: Expressing, Derivative Assay

Journal: Journal of Hematology & Oncology

Article Title: Control of triple-negative breast cancer using ex vivo self-enriched, costimulated NKG2D CAR T cells

doi: 10.1186/s13045-018-0635-z

Figure Lengend Snippet: CD25 high expression on GFP-NKG2D-z CAR T cells is essential for enrichment in the presence of IL-2. a One representative donor NKG2D CAR T cells expressed high level of CD25 and low level of CD25 by depleting human CD25 with magnetic separation on day 5 (4 days post transduction). b Percentages of CD25 high and CD25 low expressing GFP+ (NKG2D CAR) cells, presented as the mean ± SD, were derived from three independent donors during a 3-week culture period in the presence of IL-2 (50 IU/ml). c The kinetic monitoring of CD25 high and CD25 low expressing GFP (NKG2D CAR) expression on one representative donor of three in the presence of IL-2

Article Snippet: Recombinant human NKG2D Fc chimera and a control recombinant human folate receptor-alpha (FRA) Fc chimera were purchased from R&D System.

Techniques: Expressing, Transduction, Derivative Assay

Journal: Journal of Hematology & Oncology

Article Title: Control of triple-negative breast cancer using ex vivo self-enriched, costimulated NKG2D CAR T cells

doi: 10.1186/s13045-018-0635-z

Figure Lengend Snippet: Costimulated NKG2D CAR T cells inhibit tumor growth of TNBC in vivo . a NKG2D ligand expression on TNBC cell line MDA-MB-231 detected by NKG2D-Fc chimeric protein. b Growth curve of MDA-MB-231 tumor ( n = 5) treated with the control PBS, UNT T cells (3 × 10 7 ), or NKG2D CAR T cells (3 × 10 7 , ~ 30% CAR+) by intravenous injection 40 and 45 days post tumor inoculation. At the end of the experiment, the tumors treated with GFP-NKG2D-BBz or GFP-NKG2D-27z CAR T cells were significantly smaller than those in the control group and GFP-NKG2D-z group ( P < 0.001). c Bioluminescence images was applied to monitor and quantify MDA-MB-231 fLuc(+) tumor growth in NSG mice immediately before and 3 weeks after first CAR-T cell injection. d CD4+ and CD8+ GFP-NKG2D-BBz and GFP-NKG2D-27z CAR T cells were initially present at low numbers in peripheral circulation, suggesting NKG2DL-specific CAR T cell migration to specific tumor locales. Mean cell concentration (cells/ul) ± SEM for all evaluable mice in each treatment group is shown ( n = 5). e NKG2D-z CAR, but not costimulated NKG2D CAR, was poorly expressed on the surface of transduced (GFP+) T cells, suggesting CAR downregulation. f , g CD27 and 4-1BB signaling enhances the survival of circulating human CD4+ and CD8 +T cells in vivo 3 weeks after first dose of T cell infusion( P < 0.01) and costimulated NKG2D CAR expression on the T cell surface is stable and increased in vivo

Article Snippet: Recombinant human NKG2D Fc chimera and a control recombinant human folate receptor-alpha (FRA) Fc chimera were purchased from R&D System.

Techniques: In Vivo, Expressing, Injection, Migration, Concentration Assay

Journal: iScience

Article Title: Mitochondrial transfer between BMSCs and Müller promotes mitochondrial fusion and suppresses gliosis in degenerative retina

doi: 10.1016/j.isci.2024.110309

Figure Lengend Snippet: Effects of isolated mitochondria from bone marrow mesenchymal stem cells (BMSCs-mito) on the cell-cycle arrest and apoptosis rate in rotenone-injured Müller-rot cells (A) Cell cycle of normal Müller cells, Müller cells injured by rotenone (Müller-rot) and the influence of BMSCs-mito coculture. Müller-rot cells arrested at G2/M, BMSCs-mito internalization for 24 h changed the arrest. BMSCs-dmito were isolated from the BMSCs which treated by rotenone at the concentration of 0.5 μM for 24 h to get the mitochondrial dysfunction. (B) The flow analysis of apoptosis rate changed after coculture with BMSCs-mito for 24 h. Q2 showed the early apoptosis cells, Q3 showed the late apoptosis cells, and number below Q is the ratio of this type of cells (%). (C) Analysis of cell cycle. n = 3. (D) Analysis of G2/M of cell cycle. n = 3. (E) Count of early apoptosis. n = 3. (F) Count of late apoptosis. n = 3. (G) The representative images of the expression level of glial fibrillary acidic protein (GFAP) by western blot. (H) The ratio of GFAP/glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in western blot, n = 3. Data are presented as the mean ± standard deviation (SD), ns, no significance; ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001 (one-way analysis of variance [ANOVA] for D-F, H).

Article Snippet: After being exposed to rotenone for one day, Müller cells were cultivated with separated BMSCs-mito (5 × 10 6 BMSCs/30 mm well) for another 24 h. The apoptosis rate was examined through a Beyotime annexin V-FITC/PI apoptosis kit.

Techniques: Isolation, Concentration Assay, Expressing, Western Blot, Standard Deviation

Journal: iScience

Article Title: Mitochondrial transfer between BMSCs and Müller promotes mitochondrial fusion and suppresses gliosis in degenerative retina

doi: 10.1016/j.isci.2024.110309

Figure Lengend Snippet:

Article Snippet: After being exposed to rotenone for one day, Müller cells were cultivated with separated BMSCs-mito (5 × 10 6 BMSCs/30 mm well) for another 24 h. The apoptosis rate was examined through a Beyotime annexin V-FITC/PI apoptosis kit.

Techniques: Virus, Recombinant, Saline, Isolation, ATP Assay, CCK-8 Assay, Activity Assay, Apoptosis Assay, Extraction, TUNEL Assay, In Vitro, In Vivo, Software

Journal: eLife

Article Title: High-throughput profiling of sequence recognition by tyrosine kinases and SH2 domains using bacterial peptide display

doi: 10.7554/eLife.82345

Figure Lengend Snippet: ( A ) Heatmaps depicting the specificities of c-Abl, Fer, EPHB1, and EPHB2. Enrichment scores were log 2 -transformed and are displayed on a color scale from blue (disfavored sequence features, negative value), to white (neutral sequence features, near zero value), to red (favored sequence features, positive value). Values in the heatmaps are the average of three replicates. ( B ) Sequences of consensus peptides identified through X 5 -Y-X 5 screens, compared with previously reported SrcTide and AblTide sequences. ( C ) Phosphorylation kinetics of five consensus peptides against five kinases. Initial rates were normalized to the rate of the cognate consensus peptide. All peptides were used at a concentration of 100 μM, and the kinases were used at a concentration of 10–50 nM. Error bars represent the standard deviation from at least three measurements. Figure 2—source data 1. Position-specific amino acid enrichment matrices from the tyrosine kinase X 5 -Y-X 5 library screens. Matrices calculated with and without inclusion of multi-tyrosine sequences are provided.

Article Snippet: Recombinant DNA reagent , pET-His6-TEV-EPHB1(KD) , PMID: 30004690 , Addgene: 79694 , bacterial expression vector encoding the human EPHB1 kinase domain (residues 602–896) with an N-terminal His6-tag and TEV protease recognition sequence.

Techniques: Transformation Assay, Sequencing, Concentration Assay, Standard Deviation

Journal: eLife

Article Title: High-throughput profiling of sequence recognition by tyrosine kinases and SH2 domains using bacterial peptide display

doi: 10.7554/eLife.82345

Figure Lengend Snippet: Cells displaying the X 5 -Y-X 5 library were treated with a kinase cocktail containing c-Src, c-Abl, AncSZ, and EPHB1 for 3 hr, then labeled with a pan-phosphotyrosine antibody (PY20 PerCP-eFluor 710) and analyzed by flow cytometry.

Article Snippet: Recombinant DNA reagent , pET-His6-TEV-EPHB1(KD) , PMID: 30004690 , Addgene: 79694 , bacterial expression vector encoding the human EPHB1 kinase domain (residues 602–896) with an N-terminal His6-tag and TEV protease recognition sequence.

Techniques: Labeling, Flow Cytometry

Journal: eLife

Article Title: High-throughput profiling of sequence recognition by tyrosine kinases and SH2 domains using bacterial peptide display

doi: 10.7554/eLife.82345

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , pET-His6-TEV-EPHB1(KD) , PMID: 30004690 , Addgene: 79694 , bacterial expression vector encoding the human EPHB1 kinase domain (residues 602–896) with an N-terminal His6-tag and TEV protease recognition sequence.

Techniques: Clone Assay, Over Expression, Strep-tag, Recombinant, Plasmid Preparation, Sequencing, Variant Assay, Expressing, Mutagenesis, Marker, Amplification, Synthesized, Western Blot, Purification, Software

Journal: Molecular cell

Article Title: Nuclear Receptor Nur77 Facilitates Melanoma Cell Survival under Metabolic Stress by Protecting Fatty Acid Oxidation.

doi: 10.1016/j.molcel.2018.01.001

Figure Lengend Snippet: Figure 1. Nur77 Facilitates Cell Survival under Glucose Deprivation (A) Nur77 knockdown (Nur77-KD) sensitizes melanoma cells to glucose deprivation-induced cell death. Different melanoma cell lines were cultured under glucose deprivation (Glc) for the indicated times, and cell viability was determined. (B) 2DG rescues melanoma cells from glucose deprivation-induced death. MV3 cells were treated with 2DG (5 mM) or 5TG (5 mM) under glucose starvation for 9 hr, and cell viability was determined. (C and D) Knocking down Nur77 increases the NADP+/NADPH and GSSG/GSH ratios and ROS levels under glucose deprivation. MV3 cells were cultured under glucose starvation for 9 hr, and the NADP+/NADPH and GSSG/GSH ratios (C) and the levels of total and mitochondrial ROS (D) were determined. (E) NAC or GSH rescues melanoma cells from glucose deprivation-induced death. MV3 cells were treated with NAC (5 mM) or GSH (5 mM) under glucose starvation for 9 hr, and cell viability was determined. (F) NAC or GSH restores ATP levels in melanoma cells under glucose deprivation. MV3 cells were treated with NAC or GSH under glucose starvation for 9 hr, and ATP levels were detected. The data are represented as the means ± SEM of at least three independent experiments. ***p < 0.001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Dowex 1X2 chloride form 200-400 mesh Sigma-Aldrich Cat#217395; CAS:69011-19-4 Biotin-maleimide Sigma-Aldrich Cat#B1267 2-Deoxy-D-glucose (2DG) Bio Basic Inc Cat#A602241; CAS: 154-17-6 reduced glutathione (GSH) Bio Basic Inc Cat#GB0229; CAS: 70-18-8 propidium iodide (PI) Bio Basic Inc Cat#A601112; CAS: 25535-16-4 5-Thio-D-glucose (5TG) Aladdin Chemicals Cat#T107913; CAS: 20408-97-3 PD98059 MedChem Express Cat#HY-12028; CAS: 167869-21-8 Proteinase K Roche Cat#3115879001 Beetle Luciferin Promega Cat#E1605 [9,10-3H] palmitate American Radiolabeled Chemicals Cat#ART 0129 Critical Commercial Assays 10X RBC Lysis Buffer (Multi-species) eBioscience Cat#00-4300-54 XF Cell Mito Stress Test Kit Seahorse Bioscience Cat#103015-100 XF Palmitate-BSA Substrate Seahorse Bioscience Cat#102720-100 Cell Long-Chain Ketoacyl-Coenzyme A Thiolase Kit GENMED SCIENTIFICS Cat#GMS50122.1.3 ENLITEN ATP Assay System 100 assays Promega Cat#FF2000 Mitochondria Isolation Kit for Cultured Cells Thermo Fisher Scientific Cat#89874 EnzyFluo NADP+/NADPH Assay Kit BioAssay Systems Cat#EFNP-100 EnzyChrom GSH/GSSG Assay Kit BioAssay Systems Cat#EGTT-100 Experimental Models: Cell Lines HEK293T Institute of Cell Biology, China Cat#GNHu17 A375 Institute of Cell Biology, China Cat#TCHu155 MV3 Tiandz Cat#26-3610 M14 Tiandz Cat#26-3110 SK-Mel-1 ATCC Cat#HTB-67 Primary melanoma cells This paper N/A Experimental Models: Organisms/Strains BALB/cASlac-nu nude mice Slac Laboratory animal N/A Oligonucleotides pLL3.7 human Scramble shRNA: GCGCGCTTTGTAGGATTCG Wang et al., 2014 N/A pLL3.7 human Nur77 shRNA: GGGCATGGTGAAGGAAGTT Wang et al., 2014 N/A pLL3.7 human TPb shRNA: GCACAGTGACAGCTGCAAA This paper N/A pLL3.7 human Bcl-2 shRNA: GGATGACTGAGTACCTGAA This paper N/A pLKO.1 human Nix shRNA: GCTAGGCATCTATATTGGAAA This paper N/A pLKO.1 human ERK1 shRNA: CGACCTTAAGATTTGTGATTT This paper N/A pLKO.1 human ERK2 shRNA: TGGAATTGGATGACTTGCCTA This paper N/A Recombinant DNA p3xFlag-CMV10-Nur77 Wang et al., 2014 N/A p3xFlag-CMV10-Nur77 TAD Wang et al., 2014 N/A p3xFlag-CMV10-Nur77 DBD Wang et al., 2014 N/A p3xFlag-CMV10-Nur77 LBD Wang et al., 2014 N/A p3xFlag-CMV10-Nur77 LBDC465S This paper N/A p3xFlag-CMV10-Nur77 LBDC475S This paper N/A p3xFlag-CMV10-Nur77 LBDC505S This paper N/A p3xFlag-CMV10-Nur77 LBDC551S This paper N/A p3xFlag-CMV10-Nur77 LBDC566S This paper N/A p3xFlag-CMV10-Nur77S237A This paper N/A (Continued on next page) e2 Molecular Cell 69, 480–492.e1–e7, February 1, 2018

Techniques: Knockdown, Cell Culture